Review



sh5001 01 np 40 thermo  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher sh5001 01 np 40 thermo
    Sh5001 01 Np 40 Thermo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh5001+01+np+40+thermo/pm37777961-143-50-52
    Average 86 stars, based on 1 article reviews
    sh5001 01 np 40 thermo - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Protease Inhibitor:

    Article Title: CDKL5 deficiency in adult glutamatergic neurons alters synaptic activity and causes spontaneous seizures via TrkB signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Corn oil ABCONE Cat# C67366 Pentobarbital sodium Sigma Cat# P3761 Ethanol absolute Sinoreagent Cat# 10009228 Triton X-100 Sigma Cat# 9036-19-5 PBS Sigma Cat# P3744 Xylene Sigma Cat# 1330-20-7 Paraformaldehyde Sigma Cat# 30525-89-4 DAPI Sigma Cat# 28718-90-3 Chloroform Sigma Cat# 487163 Tissue-TekTM O.C.T. .. Compound SAKURA Cat# 4583 Fluoromount-G Solarbio Cat# S2100 NaF ProSpec Cat# hor-248 Na3VO4 Sigma Cat# 590088 EDTA Invitrogen Cat# 15576028 EGTA Sigma Cat# E3889 PMSF Acmec Cat# AP0100 Tris base Sigma Cat# 93350 Sucrose Sigma Cat# S0389 PhosSTOP Roche Cat# 4906837001 Protease inhibitor cocktail Acmec Cat# AC13365 NaCl Biomed Cat# SH5001-01 NP-40 Thermo Cat# 85124 SDS Beyotime Cat# ST626 Sodium deoxycholate Sigma Cat# 30968 Fat-free milk Yili Cat# 100006817794 Tween 20 Adamas life Cat# 89190D ReBlot Plus Strong Antibody Stripping Solution, 10x Sigma Cat# 2504 Chloral hydrate Sigma Cat# C8383 Trizol Invitrogen Cat# 15596026 NMDG Sigma Cat# M2004 KCl Beyotime Cat# ST345 NaH2PO4 Sigma Cat# 229903 NaHCO3 Sigma Cat# W700433 HEPES Sigma Cat# H23830 Glucose Sigma Cat# 50-99-7 Sodium pyruvate Sigma Cat# 105477 Sodium ascorbate Sigma Cat# Y0000039 Thiourea Sigma Cat# T8656 N-Acetyl-L-Cysteine Sigma Cat# PHR1098 MgSO4 NEB Cat# B1003S CaCl2 Sigma Cat# 1086436 MgCl2 Beyotime Cat# R0058 CsMeSO3 Sigma Cat# 184079 QX-314 Absin Cat# abs42026129 Mg-ATP Bioss Cat# C5068 (Continued on next page) 12 Cell Reports 42, 113202, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Na-GTP Sigma Cat# 51120 Critical commercial assays BCA protein assay kit Tiangen Cat# PA115 FD Rapid GolgiTM Kit FD NeuroTechnologies Cat# PK401 iScript cDNA Synthesis Kit Bio-Rad Cat# 1708891 LightCycler RNA Master SYBR Green I kit Roche Cat# 03064760001 TUNEL Apoptosis Assay Kit Beyotime Cat# C1098 Experimental models: Organisms/strains Cdkl5flox/flox mice Wang et al.8 Cat# JAX 030523 Camk2aCreERT2 mice Erdmann et al.46 N/A TrkBflox/flox mice Grishanin et al.47 Cat# MMRRC 033048-UCD Oligonucleotides Gapdhforward:CCCCAATGTATCCGTTGTG Chen et al.48 N/A Gapdh-reverse: CTCAGTGTAGCCCAGGATGC Chen et al.48 N/A Bdnf-forward: AGGTCTGACGACGACATCACT PrimerBank49–51 PrimerBank ID 114326460c2 Bdnf-reverse: CTTCGTTGGGCCGAACCTT PrimerBank49–51 PrimerBank ID 114326460c2 Software and algorithms Spike2 software (CED Ltd., Micro1401mkII) CED Ltd https://ced.co.uk/products/spkovin ImageJ (Fiji) Software Schneider et al.52 https://imagej.net/software/fiji/ GraphPad Prism 6 GraphPad Software https://www.graphpad.com/features Others EEG and EMG amplifiers A-M SYSTEMS Cat# 1800 Stereotaxic apparatus Harvard apparatus Cat# 75-1828 Video recording GUCEE Cat# HD98 Centrifugal machine Eppendorf Cat# 5720110011 Enhanced chemiluminescence (ECL) Analytik Jena AG Cat# 849-97-0930 Insulated silver wires Coonerwire Cat# AS633 Frozen ball mill Shanghai Jingxin Cat# JXFSTPRP Vertical Electrophoresis Cell Bio-Rad Cat# 1658001FC PVDF membrane Millipore Cat# IPVH00010 LightCycler 480 Real-Time PCR System Roche Cat# 05015243001 Cryostat Leica CM3050 VT 1200S vibratome Leica Cat# 14048142066 MultiClamp 700B amplifier Axon Instruments Cat# 1-CV-7B Digidata 1440A Axon Instruments Cat# 1-2500-0173 D FN1 microscope Nikon FN1 Borosilicate glass capillaries wpi-europe Cat# B100-20-10 Horizontal glass electrode puller Sutter Cat# P-97 Stimulation electrode FHC Cat# 55-00-13 Confocal microscope Nikon A1 Slide Scanner Olympus VS200

    Fat:

    Article Title: CDKL5 deficiency in adult glutamatergic neurons alters synaptic activity and causes spontaneous seizures via TrkB signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Corn oil ABCONE Cat# C67366 Pentobarbital sodium Sigma Cat# P3761 Ethanol absolute Sinoreagent Cat# 10009228 Triton X-100 Sigma Cat# 9036-19-5 PBS Sigma Cat# P3744 Xylene Sigma Cat# 1330-20-7 Paraformaldehyde Sigma Cat# 30525-89-4 DAPI Sigma Cat# 28718-90-3 Chloroform Sigma Cat# 487163 Tissue-TekTM O.C.T. .. Compound SAKURA Cat# 4583 Fluoromount-G Solarbio Cat# S2100 NaF ProSpec Cat# hor-248 Na3VO4 Sigma Cat# 590088 EDTA Invitrogen Cat# 15576028 EGTA Sigma Cat# E3889 PMSF Acmec Cat# AP0100 Tris base Sigma Cat# 93350 Sucrose Sigma Cat# S0389 PhosSTOP Roche Cat# 4906837001 Protease inhibitor cocktail Acmec Cat# AC13365 NaCl Biomed Cat# SH5001-01 NP-40 Thermo Cat# 85124 SDS Beyotime Cat# ST626 Sodium deoxycholate Sigma Cat# 30968 Fat-free milk Yili Cat# 100006817794 Tween 20 Adamas life Cat# 89190D ReBlot Plus Strong Antibody Stripping Solution, 10x Sigma Cat# 2504 Chloral hydrate Sigma Cat# C8383 Trizol Invitrogen Cat# 15596026 NMDG Sigma Cat# M2004 KCl Beyotime Cat# ST345 NaH2PO4 Sigma Cat# 229903 NaHCO3 Sigma Cat# W700433 HEPES Sigma Cat# H23830 Glucose Sigma Cat# 50-99-7 Sodium pyruvate Sigma Cat# 105477 Sodium ascorbate Sigma Cat# Y0000039 Thiourea Sigma Cat# T8656 N-Acetyl-L-Cysteine Sigma Cat# PHR1098 MgSO4 NEB Cat# B1003S CaCl2 Sigma Cat# 1086436 MgCl2 Beyotime Cat# R0058 CsMeSO3 Sigma Cat# 184079 QX-314 Absin Cat# abs42026129 Mg-ATP Bioss Cat# C5068 (Continued on next page) 12 Cell Reports 42, 113202, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Na-GTP Sigma Cat# 51120 Critical commercial assays BCA protein assay kit Tiangen Cat# PA115 FD Rapid GolgiTM Kit FD NeuroTechnologies Cat# PK401 iScript cDNA Synthesis Kit Bio-Rad Cat# 1708891 LightCycler RNA Master SYBR Green I kit Roche Cat# 03064760001 TUNEL Apoptosis Assay Kit Beyotime Cat# C1098 Experimental models: Organisms/strains Cdkl5flox/flox mice Wang et al.8 Cat# JAX 030523 Camk2aCreERT2 mice Erdmann et al.46 N/A TrkBflox/flox mice Grishanin et al.47 Cat# MMRRC 033048-UCD Oligonucleotides Gapdhforward:CCCCAATGTATCCGTTGTG Chen et al.48 N/A Gapdh-reverse: CTCAGTGTAGCCCAGGATGC Chen et al.48 N/A Bdnf-forward: AGGTCTGACGACGACATCACT PrimerBank49–51 PrimerBank ID 114326460c2 Bdnf-reverse: CTTCGTTGGGCCGAACCTT PrimerBank49–51 PrimerBank ID 114326460c2 Software and algorithms Spike2 software (CED Ltd., Micro1401mkII) CED Ltd https://ced.co.uk/products/spkovin ImageJ (Fiji) Software Schneider et al.52 https://imagej.net/software/fiji/ GraphPad Prism 6 GraphPad Software https://www.graphpad.com/features Others EEG and EMG amplifiers A-M SYSTEMS Cat# 1800 Stereotaxic apparatus Harvard apparatus Cat# 75-1828 Video recording GUCEE Cat# HD98 Centrifugal machine Eppendorf Cat# 5720110011 Enhanced chemiluminescence (ECL) Analytik Jena AG Cat# 849-97-0930 Insulated silver wires Coonerwire Cat# AS633 Frozen ball mill Shanghai Jingxin Cat# JXFSTPRP Vertical Electrophoresis Cell Bio-Rad Cat# 1658001FC PVDF membrane Millipore Cat# IPVH00010 LightCycler 480 Real-Time PCR System Roche Cat# 05015243001 Cryostat Leica CM3050 VT 1200S vibratome Leica Cat# 14048142066 MultiClamp 700B amplifier Axon Instruments Cat# 1-CV-7B Digidata 1440A Axon Instruments Cat# 1-2500-0173 D FN1 microscope Nikon FN1 Borosilicate glass capillaries wpi-europe Cat# B100-20-10 Horizontal glass electrode puller Sutter Cat# P-97 Stimulation electrode FHC Cat# 55-00-13 Confocal microscope Nikon A1 Slide Scanner Olympus VS200

    Stripping Membranes:

    Article Title: CDKL5 deficiency in adult glutamatergic neurons alters synaptic activity and causes spontaneous seizures via TrkB signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Corn oil ABCONE Cat# C67366 Pentobarbital sodium Sigma Cat# P3761 Ethanol absolute Sinoreagent Cat# 10009228 Triton X-100 Sigma Cat# 9036-19-5 PBS Sigma Cat# P3744 Xylene Sigma Cat# 1330-20-7 Paraformaldehyde Sigma Cat# 30525-89-4 DAPI Sigma Cat# 28718-90-3 Chloroform Sigma Cat# 487163 Tissue-TekTM O.C.T. .. Compound SAKURA Cat# 4583 Fluoromount-G Solarbio Cat# S2100 NaF ProSpec Cat# hor-248 Na3VO4 Sigma Cat# 590088 EDTA Invitrogen Cat# 15576028 EGTA Sigma Cat# E3889 PMSF Acmec Cat# AP0100 Tris base Sigma Cat# 93350 Sucrose Sigma Cat# S0389 PhosSTOP Roche Cat# 4906837001 Protease inhibitor cocktail Acmec Cat# AC13365 NaCl Biomed Cat# SH5001-01 NP-40 Thermo Cat# 85124 SDS Beyotime Cat# ST626 Sodium deoxycholate Sigma Cat# 30968 Fat-free milk Yili Cat# 100006817794 Tween 20 Adamas life Cat# 89190D ReBlot Plus Strong Antibody Stripping Solution, 10x Sigma Cat# 2504 Chloral hydrate Sigma Cat# C8383 Trizol Invitrogen Cat# 15596026 NMDG Sigma Cat# M2004 KCl Beyotime Cat# ST345 NaH2PO4 Sigma Cat# 229903 NaHCO3 Sigma Cat# W700433 HEPES Sigma Cat# H23830 Glucose Sigma Cat# 50-99-7 Sodium pyruvate Sigma Cat# 105477 Sodium ascorbate Sigma Cat# Y0000039 Thiourea Sigma Cat# T8656 N-Acetyl-L-Cysteine Sigma Cat# PHR1098 MgSO4 NEB Cat# B1003S CaCl2 Sigma Cat# 1086436 MgCl2 Beyotime Cat# R0058 CsMeSO3 Sigma Cat# 184079 QX-314 Absin Cat# abs42026129 Mg-ATP Bioss Cat# C5068 (Continued on next page) 12 Cell Reports 42, 113202, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Na-GTP Sigma Cat# 51120 Critical commercial assays BCA protein assay kit Tiangen Cat# PA115 FD Rapid GolgiTM Kit FD NeuroTechnologies Cat# PK401 iScript cDNA Synthesis Kit Bio-Rad Cat# 1708891 LightCycler RNA Master SYBR Green I kit Roche Cat# 03064760001 TUNEL Apoptosis Assay Kit Beyotime Cat# C1098 Experimental models: Organisms/strains Cdkl5flox/flox mice Wang et al.8 Cat# JAX 030523 Camk2aCreERT2 mice Erdmann et al.46 N/A TrkBflox/flox mice Grishanin et al.47 Cat# MMRRC 033048-UCD Oligonucleotides Gapdhforward:CCCCAATGTATCCGTTGTG Chen et al.48 N/A Gapdh-reverse: CTCAGTGTAGCCCAGGATGC Chen et al.48 N/A Bdnf-forward: AGGTCTGACGACGACATCACT PrimerBank49–51 PrimerBank ID 114326460c2 Bdnf-reverse: CTTCGTTGGGCCGAACCTT PrimerBank49–51 PrimerBank ID 114326460c2 Software and algorithms Spike2 software (CED Ltd., Micro1401mkII) CED Ltd https://ced.co.uk/products/spkovin ImageJ (Fiji) Software Schneider et al.52 https://imagej.net/software/fiji/ GraphPad Prism 6 GraphPad Software https://www.graphpad.com/features Others EEG and EMG amplifiers A-M SYSTEMS Cat# 1800 Stereotaxic apparatus Harvard apparatus Cat# 75-1828 Video recording GUCEE Cat# HD98 Centrifugal machine Eppendorf Cat# 5720110011 Enhanced chemiluminescence (ECL) Analytik Jena AG Cat# 849-97-0930 Insulated silver wires Coonerwire Cat# AS633 Frozen ball mill Shanghai Jingxin Cat# JXFSTPRP Vertical Electrophoresis Cell Bio-Rad Cat# 1658001FC PVDF membrane Millipore Cat# IPVH00010 LightCycler 480 Real-Time PCR System Roche Cat# 05015243001 Cryostat Leica CM3050 VT 1200S vibratome Leica Cat# 14048142066 MultiClamp 700B amplifier Axon Instruments Cat# 1-CV-7B Digidata 1440A Axon Instruments Cat# 1-2500-0173 D FN1 microscope Nikon FN1 Borosilicate glass capillaries wpi-europe Cat# B100-20-10 Horizontal glass electrode puller Sutter Cat# P-97 Stimulation electrode FHC Cat# 55-00-13 Confocal microscope Nikon A1 Slide Scanner Olympus VS200



    Similar Products

    86
    Thermo Fisher sh5001 01 np 40 thermo
    Sh5001 01 Np 40 Thermo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sh5001+01+np+40+thermo/pm37777961-143-50-52
    Average 86 stars, based on 1 article reviews
    sh5001 01 np 40 thermo - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    Image Search Results